Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: NSFT03P2_Contig15888

[Submit comment/correction]

Sequence	BE496976
Contig	Ta.8717.3.S1_at NSFT03P2_Contig15888
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC289687
wEST map position	BE496976
NCBI UniGene	Ta.8717
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001046477.1 Os02g0258900 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Germplasm	Chinese Spring
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	5AS 5BS 5DS
Clone Library	Wheat heat-stressed seedling cDNA library
Tissue	Leaf
Developmental Stage	Two-week old seedling
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE0762_A10_B20ZS Wheat heat-stressed seedling cDNA library Triticum aestivum cDNA clone WHE0762_A10_B20, mRNA sequence.
Other Name	WHE0762_A10_B20ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	TA015E1X
Clone	WHE0762_A10_B20
Probe	WHE0762_A10_B20
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Two-week old seedling were heat treated at 37 C for 2 hr and cyclic heat treated at 37 C for 2 hr for two days at Texas Tech University (D. Zhang, H. Nguyen lab). The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	Ta.8717.3.S1_at 593 WHE2AFFY TaAffx.66036.1.S1_at 145 WHE2AFFY TaAffx.66036.1.S1_at 105 WHE2AFFY
DNA	cacctacgccatagtgctccaatgcatattcgacttgttgcgccacaaac cagaatgctaccagtggaaacacgggcatcggatatgcttgtcgattcat tcgggaggtttcacaattacttgaggatctccttgactgagcgttgtaac ctgagatgtcagtactgcatgcctgccgagggagtcgagctcacgccaaa gtcagagcttctgtcacatgacgagataatccgaattgccaatctttttg ttacttctggtgtggacaagatcaggttaactggtggagaaccaaccgtt agaaaagaccttgaagatatttgcttgcatctttctggcctcaaggggct gaaaactattgcgatgaccacaaatggcatcgttctt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.