GrainGenes Sequence Report: BE492869

Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene T3 primer.

Note: Vector: Lambda pBK-CMV (Lambda Zap Express), excised phagemid; Site_1: EcoRI; Site_2: XhoI; The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova , J. Dubcovsky). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).

Note: Vector: Lambda pBK-CMV (Lambda Zap Express), excised phagemid; Site_1: EcoRI; Site_2: XhoI; The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova, J. Dubcovsky). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).

DNA

gcttcaacaaatacaatgcttgtttgaatgcaatggctactcgtatatct
acagtatttgcatcaatgagggaatttccccgtgtgcactaccgcattgc
caagaccattgatgcttctacaatgacaacactaagggacatggtgccca
caaagattgctgctggtgtatggaattaccttt


GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.