Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: NSFT03P2_Contig12707

[Submit comment/correction]

Sequence	BE492093
Contig	Ta.6954.1.S1_a_at Ta.6954.1.S1_x_at Ta.6954.3.S1_a_at NSFT03P2_Contig12707
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
DB Remark	Locus Source: Triticum monococcum
Keyword	EST
Germplasm	T. monococcum ssp. monococcum DV92
Species	Triticum monococcum
Cultivar	DV92
Clone Library	Triticum monococcum vegetative apex cDNA library
Tissue	Vegetative shoot apex
Developmental Stage	Three weeks-old plants
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE0551_E04_E04ZE Triticum monococcum vegetative apex cDNA library Triticum monococcum cDNA clone WHE0551_E04_E04, mRNA sequence.
Other Name	WHE0551_E04_E04ZE  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli XLOLR
DNA Library	TM011XXX
Clone	WHE0551_E04_E04
Remark	DB_xref: taxon:4568 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene T3 primer. Note: Vector: Lambda pBK-CMV (Lambda Zap Express), excised phagemid; Site_1: EcoRI; Site_2: XhoI; The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova , J. Dubcovsky). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda pBK-CMV (Lambda Zap Express), excised phagemid; Site_1: EcoRI; Site_2: XhoI; The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova, J. Dubcovsky). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	ggcacgaggacatcgctaaccatttctgcgagatggcggcagactaccat tcggaaaagcctcatatactggactacagtaaatatccagatatcgatga gcagaggcgtttcgtgaagacttacctgagcacttctcgcgaggaacctg aagtggaggaggtggagaatctgctccggagcgtggagaagtacacgctc gcgagtcatctggtttggggactctggggaataatatcggatcgtgtcaa cgacatcgacttcgattaccaggagtacgcaaggcagagattcgagcagt actggcagaagaagcctgccgtcctaacctcatgaacagctgaacccatg gcttcaggaactccctgaggacctgtgctgctgcacacaaactgtgcagt gttactaacacacatatcccctggctgggataatgacaggaaggatatga gagaagcatactattacaaggaagcataagcccgttccagggtcagacgt tcccatttcgaaccttgacaaggtccagcttcaggaaggaagctgtctat ggggg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.