GrainGenes Sequence Report: BE490149

Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer.

Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized , germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Five-day old seedlings were transferred to 5 C cold room and kept for 48 hr. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).

Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Five-day old seedlings were transferred to 5 C cold room and kept for 48 hr. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).

DNA Homology

Ta.8052.1.S1_at	965	WHE2AFFY
Ta.8052.1.S1_x_at	965	WHE2AFFY

DNA

tgcacctacggcgccggctacctcaagcgccaggccgtcttctcctgcct
cacctgcgtgcccgacggcgtcgccggggtctgcaccgcctgttgcctcg
cctgccacgacggccacgaggttgttgaactttggacgaagcgaaatttt
cgttgcgactgtggcaactcaaagtttggaggacacctctgcaaacttag
ccctgagagagatcctgaaaatccagcaaattcttataatcagaacttca
agggttcctactgcacatgcagtaggccctatcctgatccagaagccaag
gagcaagttgaaatgatacagtgctgtatttgtgaggactggtttcatga
agatcatattgggcttgactttttggagaagataccaagagatgaggaag
gggagccactgtatgaagaattcatatgccatcaatgctcgcctgtttgt
tatttcttgaaactctatcctgatacgatctgggcttctagtaagcagag
ttctgcatcagaagctgttactgctgattcaaatggtatg


GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.