GrainGenes Sequence Report: BE470572

Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer.

Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized , germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Five-day old seedlings were incubated for one day at 90% RH. After removing endosperm, seedlings were transferred to desiccator jar containing saturated MgSO4 at room temperature for 24 hr. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).

Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Five-day old seedlings were incubated for one day at 90% RH. After removing endosperm, seedlings were transferred to desiccator jar containing saturated MgSO4 at room temperature for 24 hr. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).

DNA

ttttttttttttttttttttctactggaagttactttcatcaactttctg
ttgctgaacaagcagatccagaggtagcaacaaacgggaagagaaaatac
aacaaagtctcagaaaaaagtttgccaagtcccagcgggaaggtaataaa
gaaacataaatatgttgaatcttgaccacctctaaattaatcaccacgaa
gctaggacttggccctaacgcgcacacgccgacgacgaagacgacaacaa
caaccaacagcagcagcagcagcagcaaattattgctatctatcaaacaa
tgatggtgngtggtgatactaccaacaggctggagcaccatggaattatg
ggatgctccaggcggactgttgacgatagggtggggggtatcctgtcatt
tacagagtcgcaaacagcgtcgtttccttgttccatcgttcgttctcggg
ttcgggttcccttg


GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.