GrainGenes Sequence Report: BE455811

HVSMEg0015F03f Hordeum vulgare pre-anthesis spike EST library HVcDNA0008 (white to yellow anther) Hordeum vulgare subsp. vulgare cDNA clone HVSMEg0015F03f, mRNA sequence.

Strain

lab_host SOLR

vulgare

Clone

HVSMEg0015F03f

Probe

[Bcl104ct383cn1667]

{SpCl-191}

BE455811

Remark

DB_xref: taxon:112509

Feature: source: mol_type = 'mRNA';

Locus Comment: On Jul 26, 2000 this sequence version replaced gi:13154679.; Contact: Wing RA; Clemson University Genomics Institute; Clemson University; 100 Jordan Hall, Clemson, SC 29634, USA; Tel: 864 656 7288; Fax: 864 656 4293; Email: rwing@clemson.edu; Total hq bases = 192; Seq primer: AATTAACCCTCACTAAAGGG; High quality sequence stop: 531.

Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; Plants were grown in the greenhouse at the University of California, Riverside (Fenton, SJ Close, TJ Close). Whole spike with awns trimmed were collected at white, green and yellow anther stages (Fenton). Total RNA was prepared from each pool, equal quantities of all three RNA pools were combined, poly(A) RNA was purified from the mixture, one primary unamplified cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids. These steps were performed in the TJ Close lab (Choi) at the University of California, Riverside. Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing) Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch , Henry, Simmons, Oates, Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http:

Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; Plants were grown in the greenhouse at the University of California, Riverside (Fenton, SJ Close, TJ Close). Whole spike with awns trimmed were collected at white, green and yellow anther stages (Fenton). Total RNA was prepared from each pool, equal quantities of all three RNA pools were combined, poly(A) RNA was purified from the mixture, one primary unamplified cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids. These steps were performed in the TJ Close lab (Choi) at the University of California, Riverside. Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing) Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates, Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http:

DNA

ccatccctccctcgtacgcacgcacgcacgcacgcactcgcgcttcgctt
ttattaacccgtttgctgcccaggccattggattcgtggcgttggcgagc
gtggtcgccagcaggagaagagggacggcggcggcggcgactgttcgcgg
gatgagcttcggcggcgccagctccgtcgcggccggtgcgaagcggccgt
tcgagtacgggaggacgcatgtggtgaggcccaagggggcgcacaaggcc
accatcgtctggcttcacggcctcggcgacaatggagccagctggtctca
actgttggaaactcttccccttcctaatataaaatggatttgcccaactg
cacctacgaggcccgtggcaatttttggtggattcccatctactgcatgn
gttgacgttgctgatctttcagaagattctcctgatgatgttgaggggct
ggattcctcagctgcacatgttgcaaatttattgtctaccgaacctgcag
acatcaagcttggtgttggtggctttagtatgggtgctgctactgcnngc
ttactccgtactttgcttgctcatggg


GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.