Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: NSFT03P2_Contig16747

[Submit comment/correction]

Sequence	BE446610
Contig	Ta.9789.1.S1_a_at Ta.9789.1.S1_at Ta.9789.2.S1_a_at NSFT03P2_Contig16747
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC315561
wEST map position	BE446610
NCBI UniGene	Ta.54382
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to XP_001703135.1 small rab-related GTPase [Chlamydomonas reinhardtii]'
Keyword	EST
Germplasm	Chinese Spring
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	3AS 3DS
Clone Library	Wheat etiolated seedling root normalized cDNA library
Tissue	Root
Developmental Stage	Five day old etiolated seedling
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE1458_D03_H06ZS Wheat etiolated seedling root normalized cDNA library Triticum aestivum cDNA clone WHE1458_D03_H06, mRNA sequence.
Other Name	WHE1458_D03_H06ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli DH10B
DNA Library	TA008E3N
Clone	WHE1458_D03_H06
Probe	WHE1458_D03_H06
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. The cDNA clones were in vivo excised to give pBluescript phagemids before normalization was carried out. The mass excision of phagemid library and normalization were done in HT Nguyen lab by D. Zhang at Texas Tech Univeristy. Normalization protocol used was that of Soares. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	Ta.9789.1.S1_a_at 1005 WHE2AFFY [ Show all 21 ]
DNA	ctatcaagttgcaaatctgggacactgctgggcaagaacgttttagaact attaccagcagctactaccgaggggcccatgggattattattgtctatga cgtgacagaccaagatagcttcaacaatgtgaagcagtggctcaacgaga ttgaccgctatgccagtgagaatgtgaacaagcttctcgtggggaacaaa tgtgatctggctgacaaaagagctgtgtcatatgaaacagcaaaggcatt tgctgatgagattggcatcccattcatggagaccagtgcaaagaacgccc tgaatgttgaacaggctttcatggccatggctgcttcgatcaaggatagg atggcgagccagccagccgcaaacaacgctcgcccagctactgtacagat ccgcgggcaacctgtcgagcagaaggccagctgctgctcttcttagaaaa ccatgcaaacttgttgatgctccgtcacctttatacatgttttcttattt gtttttacttgttatctttattcttttctttctagtgtacctgccttctg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.