GrainGenes Sequence Report: Ta.2892.2.A1_a_at
Sequence
BE445696
Contig
Ta.2892.2.A1_a_at Ta.2892.3.S1_a_at NSFT03P2_Contig17075
Tracefile
[ Download ] [ View ]
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC279411
wEST map position
BE445696
NCBI UniGene
Ta.2892
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001051935.1 Os03g0854100 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Germplasm
Chinese Spring
Species
Triticum aestivum
Cultivar
Chinese Spring
Chromosome
5DL
Clone Library
Wheat etiolated seedling root normalized cDNA library
Tissue
Root
Developmental Stage
Five day old etiolated seedling
Data Source
genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title
WHE1452_G08_M16ZS Wheat etiolated seedling root normalized cDNA library Triticum aestivum cDNA clone WHE1452_G08_M16, mRNA sequence.
Other Name
WHE1452_G08_M16ZS  [ wEST-mySQL (obsolete) ]
Strain
lab_host E. coli DH10B
DNA Library
TA008E3N
Clone
WHE1452_G08_M16
Probe
WHE1452_G08_M16
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. The cDNA clones were in vivo excised to give pBluescript phagemids before normalization was carried out. The mass excision of phagemid library and normalization were done in HT Nguyen lab by D. Zhang at Texas Tech Univeristy. Normalization protocol used was that of Soares. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology
Ta.2892.2.A1_a_at 620 WHE2AFFY Ta.2892.2.A1_a_at 468 WHE2AFFY Ta.6872.1.S1_a_at 60 WHE2AFFY Ta.6872.1.S1_x_at 60 WHE2AFFY
DNA
tggagccttggtgtaaaaaagctcactacaaagtcaaatgaaagcctgta
tgatcagaaacctgaagagccaaaacctgctttaccaacaatgacgacta
ctacttcagctgcaaaaagtggcccatcctcacattcacgttttcaatac
atggaaaatgagccatcaacagaatcaaaaactggaggaggcaacaagac
tggccatgtagcagcaccaaaaacctcagacttctttcatgagtatggaa
tggataatggcttccaaaggaaaacaagcacagctgcctcaaagactcag
atagaggaaactgatgaagcaaggaagaaattttcgaacgcgaaagcaat
ttcatcatcacagtattttggtaacacagacagagagcaaaaggaggctc
agttatctcttcaaaagttttcgggttcatcatccatttcaagcgctgat
ctgtttggccgtgatacaaatgattctgatctggacgcaagtgctgcaga
tctcatcaacagaatatctt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Ta.2892.2.A1_a_at
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
| |||||||||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
