Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TraesCS5A01G523100.1

[Submit comment/correction]

Sequence	TraesCS5A01G523100.1
Germplasm	Chinese Spring
Species	Triticum aestivum
Probe	TraesCS5A01G523100
Gene Product	Photosystem II reaction center protein J
Reference	IWGSC et al. (2018) Shifting the limits in wheat research and breeding using a fully annotated reference genome Science 361.
DNA	ATGTGGAGGAAAGTAGGGGAAATGGCCGATACTTTTGGAAGAATTCCTCT TTGGCTGGTAGGTACTGTAGCTGGTATTGCTGTGATTGGTTTAGTAGGTG TATTCTTTTATGGTTCATATTCTCGATTGGGTTCATCTCTATAG

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.