Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ta.25456.1.S1_at

[Submit comment/correction]

Sequence	BE442655
Contig	Ta.25456.1.S1_at NSFT03P2_Contig14411
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC324570
wEST map position	BE442655
NCBI UniGene	Ta.55285
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001031506.1 LCD1 (LOWER CELL DENSITY 1) [Arabidopsis thaliana]'
Keyword	EST
Germplasm	Chinese Spring
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	2AS 2BS 2DS
Clone Library	Wheat etiolated seedling root normalized cDNA library
Tissue	Root
Developmental Stage	Five day old etiolated seedling
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE1101_D04_G07ZS Wheat etiolated seedling root normalized cDNA library Triticum aestivum cDNA clone WHE1101_D04_G07, mRNA sequence.
Other Name	WHE1101_D04_G07ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli DH10B
DNA Library	TA008E3N
Clone	WHE1101_D04_G07
Probe	WHE1101_D04_G07
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. The cDNA clones were in vivo excised to give pBluescript phagemids before normalization was carried out. The mass excision of phagemid library and normalization were done in HT Nguyen lab by D. Zhang at Texas Tech Univeristy. Normalization protocol used was that of Soares. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	Ta.25456.1.S1_at 1031 WHE2AFFY Ta.25456.1.S1_at 315 WHE2AFFY TaAffx.88081.1.S1_at 58 WHE2AFFY
DNA	gttctggtcagaattcgagttgtatgcagcagatatgttggtaggcgtag ttgttaatgttgctttagttggcatgttagcaccatatgctcgattccgt ggggggtctgcatcagcaggtattcttgggcgtgttaggcatgcttatga tgctctcccgagcagtgtttttgaagctgaaaggccaggatacagttttt ccattcgacaacggctcggatcataccttctcaagggacttttatatggt gcagttggattttcttgtggtcttgttggccaaggcattgcaaacttgat aatgactgcaaagcggagtgtgaagaagtcagagaatgatgtacctgttc cacctcttctgaaaacttctgctttgtgggggtgtgttccttggtgtctc gtccaacacccgttatcaggtaattaatggtcttgagcggtatggttgag gcttcgcctcttggcaagcgtgtcccagctgcttctttggcattcactgt cagcgtgcgctttgcaaataacgtctatggaggaatgcaatttgtggatt gggc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.