Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: NSFT03P2_Contig15811

[Submit comment/correction]

Sequence	BE426174
Contig	NSFT03P2_Contig15811
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC282269
wEST map position	BE426174
NCBI UniGene	Ta.32161
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_001048631.1 Os02g0832800 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Germplasm	Chinese Spring
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	6AS 6BL 6DL
Clone Library	Wheat unstressed seedling shoot cDNA library
Tissue	Etiolated shoot
Developmental Stage	Five day old seedling
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE0329_H01_O01ZS Wheat unstressed seedling shoot cDNA library Triticum aestivum cDNA clone WHE0329_H01_O01, mRNA sequence.
Other Name	WHE0329_H01_O01ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	TA006E1X
Clone	WHE0329_H01_O01
Probe	WHE0329_H01_O01
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized , germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Shoots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Shoots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	TaAffx.123762.1.S1_at 480 WHE2AFFY TaAffx.123762.1.S1_at 145 WHE2AFFY TaAffx.123762.1.S1_at 394 WHE2AFFY
DNA	agttgcttcaaagtttccactatttatatcacaggatggaacaaatggag aagtaaaaaagaaagctttgagttacactcaaataacatttatgcagcat gtggatcttgagcctgtgcgcactgaaagaccaggagaaaacgttgcata ttacaagatagctaaccactataaatgggccttggatgagctattcatta agcatgattttcgtcgagtaatcattctggaagatgacatggagatcgcc ccagatttctttgactactttgaggctgcagcgaaattacttgacactga caagtcgataatggctgtttcttcttggaatgacaatgggcaaaagcagt ttgtttatgacccaaaggctctttaccgttcggatttctttcctgggctt ggatggatgctaacgaagtcaacatggatggagctgtcaccaaagtggcc caaagcttattgggatgactgggtgaggctaaaggaggtacacagagatc ggcagtttattcggccagaagtatgcagaacatacaactttggcgagcat ggatcaagcatgggacaattctttgatcaatacttgaaaccaatcaaatt aaatgatgctcatattgactggaattccg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.