Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: avgbs_217000.1

[Submit comment/correction]

Sequence	avgbs_217000.1
Species	Avena sativa
Probe	avgbs_217000.1
Reference	Bekele WA et al. (2018) Haplotype based genotyping-by-sequencing in oat genome research Plant Biotechnology Journal.
DNA	tgcagaggcagcaagcaagcaaagcgtggtcagcgatcctcaagaaacga aaacgcgggtgccR

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.