GrainGenes Sequence Report: BE424179
Sequence
BE424179
Contig
Ta.9244.1.S1_x_at
Tracefile
[ Download ] [ View ]
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC284317
wEST map position
BE424179
NCBI UniGene
Ta.1546
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_001045083.1 Os01g0896800 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Germplasm
CHEYENNE
Species
Triticum aestivum
Cultivar
Cheyenne
Chromosome
2AS 2DL
Clone Library
Wheat endosperm cDNA library
Tissue
Endosperm
Developmental Stage
5 to 30 days post anthesis seed
Data Source
genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title
WHE0075_G09_M17ZS Wheat endosperm cDNA library Triticum aestivum cDNA clone WHE0075_G09_M17, mRNA sequence.
Other Name
WHE0075_G09_M17ZS  [ wEST-mySQL (obsolete) ]
Strain
lab_host E. coli SOLR
DNA Library
TA001E1X
Clone
WHE0075_G09_M17
Probe
[Wcl591ct1402cn1925] {SpCl-31} WHE0075_G09_M17
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda ZAP II, excised phagemid; Site_1: EcoRI; Seeds collected, endosperm isolated, and RNA prepared by Susan Altenbach. Library constructed by Stratagene, Inc. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab.
DNA Homology
Ta.9244.1.S1_x_at 724 WHE2AFFY Ta.28291.2.S1_x_at 474 WHE2AFFY Ta.28291.4.S1_x_at 460 WHE2AFFY Ta.28291.4.S1_at 460 WHE2AFFY TaAffx.59246.1.S1_at 111 WHE2AFFY
DNA
gccgccgccgccgccgcagcagcaacagcaggcgagcgagatggtgtttg
tgaagaaccagaagaccagggcctactccaagcgcttccaagtgaagttc
aagagaaggagacaggggaagaccgattacagggccaggctcaggctcac
caaccaagacaagaacaagtacaatacacccaagtaccggtttgttgtac
gatttaccaacaaagatgtcactgcccaaattgtgtacgccaccattgct
ggtgatatcgtgatggctgctgcctattctcatgagcttcctcgatatgg
tcttgaagttggcctcaccaactatgctgcagcttactgtactggtctgc
ttttggcccgccgtgtgctcaagtgccgtgatttggatcaggaatatgag
ggcaatgttgaggccactggggaggacttctctgttgagccggctgatga
gagga

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: BE424179
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
| ||||||||||||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
