Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TP25084

[Submit comment/correction]

Sequence	TP25084
Locus	TP25084
Species	Aegilops umbellulata
BLAST, e-value	4e-12 chr3A IWGSC_v0.4_match
DNA	tgcagctctggagcaggagaggaggcagcagagcggcgccgaaaaaaaaa aaaaaaaaaaaaaa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.