GrainGenes Sequence Report: NSFT03P2_Contig18693
Sequence
BE423077
Contig
Ta.28365.1.S1_s_at NSFT03P2_Contig18693
Tracefile
[ Download ] [ View ]
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC344203
NCBI UniGene
Ta.28365
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_001065684.1 Os11g0135400 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Germplasm
CHEYENNE
Species
Triticum aestivum
Cultivar
Cheyenne
Clone Library
Wheat endosperm cDNA library
Tissue
Endosperm
Developmental Stage
5 to 30 days post anthesis seed
Data Source
genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title
WHE0060_D02_G04ZS Wheat endosperm cDNA library Triticum aestivum cDNA clone WHE0060_D02_G04, mRNA sequence.
Other Name
WHE0060_D02_G04ZS  [ wEST-mySQL (obsolete) ]
Strain
lab_host E. coli SOLR
DNA Library
TA001E1X
Clone
WHE0060_D02_G04
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda ZAP II, excised phagemid; Site_1: EcoRI; Seeds collected, endosperm isolated, and RNA prepared by Susan Altenbach. Library constructed by Stratagene, Inc. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab.
DNA
gtaactaagtgcatgacataacgttaccatattcaaatacacactaacaa
acagcataattaattcttgttcaaggtaatgataggactgaaaaacttta
gtgttcaacactaaacaaaactggcaacgggacacggctttatgaagata
ggcacacagcttagtcgtcgaacaggctgaatcccatctcgccatctgat
tcctcctcgggctcatccttcttctcctcctccttgggggcagcggcggc
agcaccaccagaggcagcagcagcaggggcagcaacggcaaacttgctgg
ggtccttgaggtactccttgatcttatcagcatggtcatatgagtagtct
gtctccaaagcaaccgcaagaacattcttgtatgcgttgaggaacatgtg
aggcgcagcagccatggtggggtatgagatcgccagggacagtgaagcaa
ccatggaaacaccagatgcaaacttgtccatcaggtcttcctcggtgagg
tcaagaacctcagggctgaagactgacccactgtcatagacattgcagat
gaccagtccatatgagaaggggcggataccaagcttggcaagcagggcag
actcagaggagcccaccttgtcacctttcttgattagcttcactgggata
gtaatttccacagtacccttg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: NSFT03P2_Contig18693
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
