GrainGenes Sequence Report: NSFT03P2_Contig17817
Sequence
BE422467
Contig
Ta.9176.1.S1_at NSFT03P2_Contig17817
Tracefile
[ Download ] [ View ]
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC286104
NCBI UniGene
Ta.54382
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to XP_001703135.1 small rab-related GTPase [Chlamydomonas reinhardtii]'
Keyword
EST
Germplasm
CHEYENNE
Species
Triticum aestivum
Cultivar
Cheyenne
Clone Library
Wheat endosperm cDNA library
Tissue
Endosperm
Developmental Stage
5 to 30 days post anthesis seed
Data Source
genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title
WHE0056_G11_M22ZS Wheat endosperm cDNA library Triticum aestivum cDNA clone WHE0056_G11_M22, mRNA sequence.
Other Name
WHE0056_G11_M22ZS  [ wEST-mySQL (obsolete) ]
Strain
lab_host E. coli SOLR
DNA Library
TA001E1X
Clone
WHE0056_G11_M22
Probe
[Wcl243ct893cn1332] {SpCl-82} CFE97 CFE98
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda ZAP II, excised phagemid; Site_1: EcoRI; Seeds collected, endosperm isolated, and RNA prepared by Susan Altenbach. Library constructed by Stratagene, Inc. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab.
DNA
ataaccattcaagatacacaactagaagaagatactgtctccaaactcca
tccggtgttacaagtccaacgattcaagagctaataagtacactagaaag
aatggaatgaaggtgtaagatgtagtaggcctatgtagaagcatggactc
aaggatggcgcggccaagtttgcgtctccatttgggtaacatggatggcg
gctgcctgcatttcaagaagagcagcagctcgtcttctgttcgacaggtt
gcccgcgtatctgcaccgtggctgggcgagcgctgtttgcggctggctgg
ctcgccatcctgtccttgattgaagcagacatagccatgaaagcctgctc
aacgttcaaggcattctttgcactggtctccatgaatgggatgccaatct
catcagcaaatgccttcgctgtctcatatgatacaactcttttgtcagtg
agatcaga

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: NSFT03P2_Contig17817
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
