Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Lo7_v2_contig_1543664

[Submit comment/correction]

Sequence	AX-99761675
Contig	Lo7_v2_contig_1543664
External Databases	Data at GenBank Data at EMBL Data at DDBJ
Species	Secale cereale
Probe	AX-99761675
Reference	Bauer E et al. (2017) Towards a whole-genome sequence for rye (Secale cereale L.). The Plant Journal 89:853-869.
DNA	tctatctgaccctttaccctggcaacttctgcgttRggctgctccgtatc tgctgggcaaacctgagcagt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.