Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BE406612

[Submit comment/correction]

Sequence	BE406612
Contig	NSFT03P2_Contig15988
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC277445
wEST map position	BE406612
NCBI UniGene	Ta.55562
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001054433.1 Os05g0108600 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Germplasm	Chinese Spring
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	1BS 5AL 5DL
Clone Library	Wheat etiolated seedling root cDNA library
Tissue	Root
Developmental Stage	Five day old etiolated seedling
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE0419_c09_f17zB Wheat etiolated seedling root cDNA library Triticum aestivum cDNA clone WHE0419_c09_f17, mRNA sequence.
Other Name	WHE0419_c09_f17zB  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	TA008E1X
Clone	WHE0419_c09_f17
Probe	WHE0419_c09_f17
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Strategene pBluescript SK reverse primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized , germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	Ta.14480.1.S1_x_at 371 WHE2AFFY Ta.20854.2.S1_at 52 WHE2AFFY
DNA	agatcaaccatggcttctcctcggcatctgctgaagctttcgggtgctct tctcctcctctgtgtcggcgtgtgtgtcgctcgcaacagtgacttctcca ttgtcggctactcggaggaggacctgtcgtccatcgacagactcgtcgag ctgtttgagaagtggctggccaagcaccagaaggcgtacgcgagcttcga ggaga

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.