Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BS00003558

[Submit comment/correction]

Sequence	BS00003558
Probe	BS00003558
Remark	Source: Normalised cDNA libraries
DNA	caccacaactcgctgctccggcggagcctcgccaacctccagaggaccta cccccgcaccMggatcatgtacgccgacttctacgcgcaggtcatccaga tgatccgggcccctcagaat

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.