GrainGenes Sequence Report: 1AL_3972356
Sequence
wsnp_Ra_c2227_4304970
Contig
1AL_3972356
Species
Triticum aestivum
Probe
wsnp_Ra_c2227_4304970
DNA
AGGCAATCCCTTAGAAATCCATCTTCCATTTTAGTCCGAAGCCTTGTCTT
CACAAGTTTCATGGCAGAAAATGCACGTTMTGTCGTTGCCGTTGAAACCG
RTAGAGTAAGAACAAGTCGAATCAGTCTATCAATCAAATGATATTCATCC
GATTTCCTGGTTGCTGCAAGTTGTTGACAAAGTTCTGATATACTTGTCAA
A

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3972356
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
