GrainGenes Sequence Report: tplb0061k05_719
Sequence
tplb0061k05_719
Contig
1AL_3934962
Species
Triticum aestivum
Probe
tplb0061k05_719
DNA
TTAACCATGCCACTGTGAAGACTCCCAGTGGAGAGAAGCCTGTTCGTGAA
Yttgttcaagatgatgaatggctaaatggggagttcattgccactgtcca
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: tplb0061k05_719
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
