GrainGenes Sequence Report: 1AL_588434
Sequence
tplb0060a06_202
Contig
1AL_588434
Species
Triticum aestivum
Probe
tplb0060a06_202
DNA
CTGCTTTAATTATGGCTTTAGACTATTTGATAGTTCGCAGCAACCAAACG
RACCCTCTGTGAATACTTTGGAGGGTTGCCTTCCTTCAGAGGATGAATTC
C

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_588434
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
