GrainGenes Sequence Report: 1AL_3940190
Sequence
tplb0055b10_1478
Contig
1AL_3940190
Species
Triticum aestivum
Probe
tplb0055b10_1478
DNA
CTCGACCACGCCATCAATGGCAGCTACCACGGCCTGCCCGTGCTCGCCGG
Ygtcaatgtggccgtccgttccccggacgacgagctcaagttcggggtgg
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3940190
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
