GrainGenes Sequence Report: 1AL_3974985
Sequence
tplb0049k18_224
Contig
1AL_3974985
Species
Triticum aestivum
Probe
tplb0049k18_224
DNA
TTGACAGCTAAGGTCAATCAGCACTGTACTCCACACGGCTTAAGGATGGG
YCCCTTGGGCTTGGCAATGAAGGGGTCGATCCTGACCCACACAAGGGAGA
A

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3974985
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
