GrainGenes Sequence Report: 1AL_3935783
Sequence
Tdurum_contig42515_1245
Contig
1AL_3935783
Species
Triticum aestivum
Probe
Tdurum_contig42515_1245
DNA
TTGAAAGAACTTCTAACATGACTAAAATCATACTACATAATTACTGCACA
Rttctcagactgaactctctttacatttgacagactagttattgctaata
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3935783
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
