GrainGenes Sequence Report: 1AS_1053056
Sequence
Tdurum_contig12906_704
Contig
1AS_1053056
Species
Triticum aestivum
Probe
Tdurum_contig12906_704
DNA
AACAAGCAGGTTGAGGACGGATACAATTGGAGGAAGTACGGGCAGAAGCA
Rgttaaggggagcgagaacccgcggagctactacaagtgcacctacaaca
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AS_1053056
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
