GrainGenes Sequence Report: 1AL_3958702
Sequence
Tdurum_contig10467_1037
Contig
1AL_3958702
Species
Triticum aestivum
Probe
Tdurum_contig10467_1037
DNA
CAGACTCTCCTTTACTTATTTGAACCTATCGAGTTAAAGAAAGACCAAAT
Yatggaaggttctgttaccatatctcagagccagcaacatgcccggttcc
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3958702
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
