GrainGenes Sequence Report: RAC875_s117654_199
Sequence
RAC875_s117654_199
Contig
1AL_3938907
Species
Triticum aestivum
Probe
RAC875_s117654_199
DNA
CCACCCGACATAGTTCTGGCACAAATTTTCATGTGAAGTCGCTTGAAGTA
YAAGCTTCTGAACCTGAACCTTCACGGATAATCCAGGTTCTACCTCCCGA
G

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: RAC875_s117654_199
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
