GrainGenes Sequence Report: 1AL_3928116
Sequence
RAC875_rep_c73465_334
Contig
1AL_3928116
Species
Triticum aestivum
Probe
RAC875_rep_c73465_334
DNA
CTTGATTTATTCCCCAAGATAGAGCTGAGTATTCAACGCGATTTTGCTGA
YGCTGTTCTGTATGAAGATCGGCGGAGAGTCAAATTTTTGGCTGATGGCA
C

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3928116
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
