GrainGenes Sequence Report: RAC875_rep_c114927_110
Sequence
RAC875_rep_c114927_110
Contig
1AL_3922767
Species
Triticum aestivum
Probe
RAC875_rep_c114927_110
DNA
ATATAGCCACTATAGCGCACCCCGCATTTGCTTGGTTTTGCGGCTAATGC
Ycttatcttttctgtgatatccggtccatcatctagtataaccttttgtt
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: RAC875_rep_c114927_110
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
