GrainGenes Sequence Report: 1AS_1518210
Sequence
RAC875_rep_c110776_179
Contig
1AS_1518210
Species
Triticum aestivum
Probe
RAC875_rep_c110776_179
DNA
CCCAATGCTCAAGTACGACGAAGAGCTCAGCCAGATGGCCAATAATTGCA
YGCAACTGGCCAACATGATGTGAGACGTACCCTTGCATGCAGGCAGTCAT
G

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AS_1518210
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
