GrainGenes Sequence Report: RAC875_c98547_94
Sequence
RAC875_c98547_94
Contig
1AL_644659
Species
Triticum aestivum
Probe
RAC875_c98547_94
DNA
CAGTATCTCAATCAGATGAATCAGAAAGGGACGAAGAAAATGGCGAGCCC
RTGAACGAGGATTACGATGAGCAGCTTCCAGATTATTCAAGGGACAATTC
T

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: RAC875_c98547_94
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
