GrainGenes Sequence Report: RAC875_c83508_72
Sequence
RAC875_c83508_72
Contig
1AL_3967068
Species
Triticum aestivum
Probe
RAC875_c83508_72
DNA
TGAGTTCGGATTGTATATTATCACTCTCCGCTTCTGCAGAGACAAATGCA
RTGAACTTCCCTTTTGGTGCGACGTTGTGGGTGTATGAGCAACGGAAGAC
A

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: RAC875_c83508_72
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
