GrainGenes Sequence Report: RAC875_c7568_768
Sequence
RAC875_c7568_768
Contig
1AL_3951900
Species
Triticum aestivum
Probe
RAC875_c7568_768
DNA
TTGATTAGTCCACGTGAAGAGAGGTATTCTGCCTTTTCTTTGCTCCAGCA
Rtaacccttgtaggcacttgcagcaggaccagataccgaagagcaaattt
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: RAC875_c7568_768
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
