GrainGenes Sequence Report: 1AL_3935254
Sequence
RAC875_c6596_1594
Contig
1AL_3935254
Species
Triticum aestivum
Probe
RAC875_c6596_1594
DNA
AGAGGGATGTGGACTGCATCGAGGACTACTACGATGGCGAGCAAAACGAG
YACGGCCTGGAGAACCTCGATGATGGGCAGATGAGCAGTTGCTCTATAGT
G

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3935254
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
