GrainGenes Sequence Report: 1AL_3977080
Sequence
RAC875_c62217_152
Contig
1AL_3977080
Species
Triticum aestivum
Probe
RAC875_c62217_152
DNA
AATGAGGCTCTTGTTGATCGCAATACAGCGATTAAGATGGTAGAACCAGG
Ycacttggaccagcttcttcatccacagtttgcgaaccccgaggctgctt
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3977080
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
