GrainGenes Sequence Report: RAC875_c55843_449
Sequence
RAC875_c55843_449
Contig
1AL_3944931
Species
Triticum aestivum
Probe
RAC875_c55843_449
DNA
TGAGTTGTAGAGAGGTGGGGAACCATGATCCTTCTTCGGGAAGAGACACC
RACGGCTGGGCGTCGGAGGGCTCTTCTAACACACATAAAGCAGATACATC
A

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: RAC875_c55843_449
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
