GrainGenes Sequence Report: RAC875_c3144_836
Sequence
RAC875_c3144_836
Contig
1AL_3974904
Species
Triticum aestivum
Probe
RAC875_c3144_836
DNA
GGTTCATCTCTAGAGGGAGGCACAAAAGGTTCAGGTTGGGGTTCATCTCT
MGAGGGAGGCACAAAAGGTTCAGGTTGGGGTTCATCTCTAGAGGGAAGCA
C

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: RAC875_c3144_836
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
