GrainGenes Sequence Report: 1AL_3940914
Sequence
RAC875_c26690_862
Contig
1AL_3940914
Species
Triticum aestivum
Probe
RAC875_c26690_862
DNA
AAGTATGCACCGAGGTGATAGCTCTTGCCATCTGCAAACCTCGATGGATC
RAACTCCTCCGCATTAGCTCCCCATATGTCRACATCATGGTGAATGTCAA
T

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3940914
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
