GrainGenes Sequence Report: 1AL_3976997
Sequence
RAC875_c16080_339
Contig
1AL_3976997
Species
Triticum aestivum
Probe
RAC875_c16080_339
DNA
AAGAACGGTCTTTGATTGGCAGCTCAACGATACTTGTGTGAAAACCATCG
RTGCCGCAACGCTTCCCTGGCTGTTGGTCTCTTTCTGGGGTTGATTTGCA
G

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3976997
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
