GrainGenes Sequence Report: 1AL_3969068
Sequence
Ra_c74910_425
Contig
1AL_3969068
Species
Triticum aestivum
Probe
Ra_c74910_425
DNA
TACCCCTGTGGCATGCTCGATATGAATTCATGGGCATTGGCTGCTTTAGC
RGCCGCAGCAATCTCTTCCTCGGTTACCTCTTCATGCTTACCGTATGCTA
T

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3969068
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
