GrainGenes Sequence Report: 1AS_1500352
Sequence
Ra_c72462_718
Contig
1AS_1500352
Species
Triticum aestivum
Probe
Ra_c72462_718
DNA
tgaagagagcccatagtggcaaactcataagcaaggacacgggtgttccc
Rtcaagacagtaaccaagcaactccacaacattttcatgcttaagccttg
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AS_1500352
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
