GrainGenes Sequence Report: Ra_c43812_239
Sequence
Ra_c43812_239
Contig
1AL_3976129
Species
Triticum aestivum
Probe
Ra_c43812_239
DNA
ATATCTCAAAGGGCTCCTCTTAAGGATGCCATTCAGGCAACCGGGAGAAG
RACATGGGGAGCAACGTTTCGTTTATCACCACTCCATGTTTCTTGTGGTA
G

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Ra_c43812_239
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
