GrainGenes Sequence Report: Ra_c39369_522
Sequence
Ra_c39369_522
Contig
1AL_3937954
Species
Triticum aestivum
Probe
Ra_c39369_522
DNA
GTGGAAGGCTTATATGGAATGATCCGTGACAATGTCAAGAAAGAATTATC
Ygcattgctcttgcatgctattcaggtcccgagaattataaaagccagta
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Ra_c39369_522
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
