GrainGenes Sequence Report: Ra_c31686_231
Sequence
Ra_c31686_231
Contig
1AL_3977575
Species
Triticum aestivum
Probe
Ra_c31686_231
DNA
TCTTCATCACTTTTACATGCAATCCGAAATGGCCGGAAATACAGGATATG
YTGGATCTGATTCCAGGCCAGAAACCTGAAGATCGTCCAGACATTGTTGC
C

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Ra_c31686_231
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
