GrainGenes Sequence Report: Ra_c2227_308
Sequence
Ra_c2227_308
Contig
1AL_3972356
Species
Triticum aestivum
Probe
Ra_c2227_308
DNA
TTTAGTCCGAAGCCTTGTCTTCACAAGTTTCATGGCAGAAAATGCACGTT
MTGTCGTTGCCGTTGAAACCGGTAGAGTAAGAACAAGTCGAATCAGTCTA
T

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Ra_c2227_308
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
