GrainGenes Sequence Report: Ra_c100507_1004
Sequence
Ra_c100507_1004
Contig
1AL_3976383
Species
Triticum aestivum
Probe
Ra_c100507_1004
DNA
TTCCTCGTCCTCGCACCGGCTCAGCTGGCTCTGCAGCGTCCTCCGTGGAG
Ragactttgccgtgtcgccgttctcacgaaatgcaacaggcacaggcaca
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Ra_c100507_1004
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
