GrainGenes Sequence Report: 1AL_3977557
Sequence 
Kukri_rep_c75458_277 
Contig 
1AL_3977557 
Species 
Triticum aestivum 
Probe 
Kukri_rep_c75458_277 
DNA 
ACTGTGCTTGAGATGTTAGGTAAGATGCCAATGAAGGAAAAACACCAGGT
KACAGCACCTTCTAGCAGTTCAGTTGACATGGATGTCAGGGGGGATAGAG
G

 
 
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
 
 
GrainGenes Sequence Report: 1AL_3977557
| 
 | 
 | ||
| 
 | 
 | ||
| 
 | 
 | ||
| 
 | 
 | ||
| 
 | 
 | 
|  
     GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
