GrainGenes Sequence Report: Kukri_rep_c69775_747
Sequence
Kukri_rep_c69775_747
Contig
1AL_3967260
Species
Triticum aestivum
Probe
Kukri_rep_c69775_747
DNA
CAGGTATACATTCCTTGGTGGTTTGAGGCCACTATCCCTAGCTAAACCTC
RTTTCCCCAAAATATGTTTACAGTTGAATCTTCTTACAATAAGCACCAAA
T

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Kukri_rep_c69775_747
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
