GrainGenes Sequence Report: 1AL_3977131
Sequence
Kukri_rep_c111709_265
Contig
1AL_3977131
Species
Triticum aestivum
Probe
Kukri_rep_c111709_265
DNA
GGCCACCCTTCAATCACCAATTGTGAACAGGCAAACAATTCTTCAGCTCA
MATGCATAGGCTTGATCTAGAGGACACATGAACTTCGATGGTGAGGAGAT
C

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3977131
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
